View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_205 (Length: 203)
Name: NF0583_low_205
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_205 |
 |  |
|
[»] chr1 (5 HSPs) |
 |  |
|
[»] chr3 (8 HSPs) |
 |  |
|
[»] chr2 (6 HSPs) |
 |  |
|
[»] chr8 (9 HSPs) |
 |  |
|
[»] chr7 (4 HSPs) |
 |  |
|
[»] chr6 (5 HSPs) |
 |  |
|
[»] chr5 (14 HSPs) |
 |  |
|
[»] chr4 (11 HSPs) |
 |  |
|
[»] scaffold0381 (1 HSPs) |
 |  |
|
[»] scaffold0360 (2 HSPs) |
 |  |
|
[»] scaffold0214 (3 HSPs) |
 |  |
|
[»] scaffold0062 (2 HSPs) |
 |  |
|
[»] scaffold0035 (1 HSPs) |
 |  |
|
[»] scaffold0014 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 3e-25; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 145 - 203
Target Start/End: Complemental strand, 1950961 - 1950903
Alignment:
Q |
145 |
ttaggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1950961 |
ttaggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
1950903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 37641466 - 37641521
Alignment:
Q |
148 |
ggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||| |||||||||||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
T |
37641466 |
ggagcaaagccggcaacgacagaactctatcggtttattttctttattatgttgtt |
37641521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 36 - 82
Target Start/End: Complemental strand, 1951069 - 1951023
Alignment:
Q |
36 |
agagaagccacgttttcgaagaaaggaattaggcattcacgcagcac |
82 |
Q |
|
|
|||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
T |
1951069 |
agagaagccatgttttggaagaaaggaattaggcattcacgcagcac |
1951023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 49715985 - 49716027
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
49715985 |
caacgacggaactctatcggtttattttctttactatgttgtt |
49716027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 49719468 - 49719510
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
49719468 |
caacgacggaactctatcggtttattttctttactatgttgtt |
49719510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 8e-23; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 145 - 203
Target Start/End: Original strand, 10884559 - 10884617
Alignment:
Q |
145 |
ttaggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
10884559 |
ttaggagctaagccggcaacgacggaactttattggtttattttctttactatgttgtt |
10884617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 145 - 203
Target Start/End: Complemental strand, 10107091 - 10107033
Alignment:
Q |
145 |
ttaggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
10107091 |
ttagaagctaagccggcaacgacggaatcctattggtttattttctttactatgttgtt |
10107033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 36 - 82
Target Start/End: Original strand, 10884451 - 10884497
Alignment:
Q |
36 |
agagaagccacgttttcgaagaaaggaattaggcattcacgcagcac |
82 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
10884451 |
agagaagccacgttttggaagaaaggaattaggcattcacgcagcac |
10884497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 35 - 82
Target Start/End: Complemental strand, 10107201 - 10107154
Alignment:
Q |
35 |
cagagaagccacgttttcgaagaaaggaattaggcattcacgcagcac |
82 |
Q |
|
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
T |
10107201 |
cagagaagccacgttttggaagagaggaattaggcattcacgcagcac |
10107154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 147 - 203
Target Start/End: Complemental strand, 2280134 - 2280078
Alignment:
Q |
147 |
aggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| | |||||||||||||||| ||||| |||||||||||||||| |||||||| |
|
|
T |
2280134 |
aggagcaacgccggcaacgacggaattctatcggtttattttctttacaatgttgtt |
2280078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 201
Target Start/End: Complemental strand, 17532125 - 17532071
Alignment:
Q |
147 |
aggagctaagccggcaacgacggaactctattggtttattttctttactatgttg |
201 |
Q |
|
|
|||||| | |||| ||||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
17532125 |
aggagcaatgccgacaacgacggaactctttcgctttattttctttactatgttg |
17532071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 30158543 - 30158501
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
T |
30158543 |
caacgatggaactctatcggtttattttctttattatgttgtt |
30158501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 44508425 - 44508466
Alignment:
Q |
162 |
aacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||| ||||| | ||||||||||||||||||||||| |
|
|
T |
44508425 |
aacgacggaattctatcgatttattttctttactatgttgtt |
44508466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 38005681 - 38005632
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
38005681 |
aagccggcaacgacggaactctatcggtttattttctttactatgttgtt |
38005632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 29435365 - 29435407
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
29435365 |
caacgacggaactctatcggtttattttctttactatgttgtt |
29435407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 15704475 - 15704433
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
15704475 |
caacgacgaaactctatcggtttattttctttactatgttgtt |
15704433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 15719729 - 15719687
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
15719729 |
caacgacgaaactctatcggtttattttctttactatgttgtt |
15719687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 4577459 - 4577508
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||| | |||||| | ||||||||||||||||||||||| |
|
|
T |
4577459 |
aagccggcaacgacgaagctctatcgatttattttctttactatgttgtt |
4577508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 10600575 - 10600620
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||| ||| ||||||||||||||||||| ||||| |
|
|
T |
10600575 |
cggcaacgacggaactttatcggtttattttctttactatattgtt |
10600620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 5963855 - 5963910
Alignment:
Q |
148 |
ggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
T |
5963855 |
ggagcaaagccggcaacgacggaactctatcggtttattttctttattatgttgtt |
5963910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 45155768 - 45155719
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
45155768 |
aagccggcaacgacggaactctatatgtttattttctttactatgttgtt |
45155719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 147 - 203
Target Start/End: Complemental strand, 18721786 - 18721730
Alignment:
Q |
147 |
aggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| | |||| |||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
18721786 |
aggagcaacgccgacaacgacgaaactctatcggtttattttctttactatgttgtt |
18721730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 18696431 - 18696389
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
18696431 |
caacgacgaaactctatcggtttattttctttactatgttgtt |
18696389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 25591964 - 25591922
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
25591964 |
caacgacgaaactctatcggtttattttctttactatgttgtt |
25591922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 14421370 - 14421411
Alignment:
Q |
159 |
ggcaacgacggaactctattggtttattttctttactatgtt |
200 |
Q |
|
|
||||||||||||| ||||| |||||||||||||||||||||| |
|
|
T |
14421370 |
ggcaacgacggaattctatcggtttattttctttactatgtt |
14421411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 31984603 - 31984652
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| |||||||| | |||||| ||||||||||||||||||||||||| |
|
|
T |
31984603 |
aagccgacaacgacgaagctctatcggtttattttctttactatgttgtt |
31984652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 203
Target Start/End: Complemental strand, 25595162 - 25595106
Alignment:
Q |
147 |
aggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| | |||| |||||||| |||||||| |||||||||| |||||||||||||| |
|
|
T |
25595162 |
aggagcaacgccgacaacgacgaaactctatcggtttattttttttactatgttgtt |
25595106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 161 - 200
Target Start/End: Original strand, 23613169 - 23613208
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgtt |
200 |
Q |
|
|
|||||||| |||||||| |||||||||||||||||||||| |
|
|
T |
23613169 |
caacgacgaaactctatcggtttattttctttactatgtt |
23613208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 148 - 203
Target Start/End: Complemental strand, 11825875 - 11825820
Alignment:
Q |
148 |
ggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
T |
11825875 |
ggagcaaagccggcaacgacggaactctatcggtttattttctttattatgttgtt |
11825820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 8276614 - 8276663
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
T |
8276614 |
aagccggcaacgacggaactctatcagtttattttctttattatgttgtt |
8276663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 10431933 - 10431978
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
T |
10431933 |
cggcaacgacggaactctaatggtttattttctttactaggttgtt |
10431978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 8397458 - 8397512
Alignment:
Q |
148 |
ggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
T |
8397458 |
ggagcaaagccggcaacgacggaactcta-cggtttattttctttattatgttgtt |
8397512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 5738578 - 5738533
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
5738578 |
cggcaacgacggaactctatcggtttattttctttactatgttgtt |
5738533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 11410379 - 11410421
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
11410379 |
caacgacggaactctatcggtttattttctttactatgttgtt |
11410421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 1126227 - 1126178
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||||||| |||||||| | |||||||||||||| |
|
|
T |
1126227 |
aagccggcaacgacggaactctatcggtttattgtttttactatgttgtt |
1126178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 147 - 203
Target Start/End: Complemental strand, 23388604 - 23388548
Alignment:
Q |
147 |
aggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| | |||| |||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
23388604 |
aggagcaacgccgacaacgacgaaactctatcggtttattttctttactatgttgtt |
23388548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 31262386 - 31262437
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtt--tattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
T |
31262386 |
aagccggcaacgatggaactctattggtttatattttctctactatgttgtt |
31262437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 14)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 21333179 - 21333130
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
21333179 |
aagccggcagcgacggaactctatcggtttattttctttactatgttgtt |
21333130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 21336195 - 21336146
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
21336195 |
aagccggcagcgacggaactctatcggtttattttctttactatgttgtt |
21336146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 22937431 - 22937386
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
22937431 |
cggcaacgacggaactctatcggtttattttctttactatgttgtt |
22937386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 2452949 - 2452995
Alignment:
Q |
157 |
ccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
T |
2452949 |
ccggcaacgacggaactctatggatttattttctttactatgttgtt |
2452995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 28441629 - 28441583
Alignment:
Q |
157 |
ccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
T |
28441629 |
ccggcaacgacggaactctatcggtttattttctttactacgttgtt |
28441583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 40916229 - 40916188
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttact |
195 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
40916229 |
aagccgacaacgacggaactctattggtttattttctttact |
40916188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 26547692 - 26547747
Alignment:
Q |
148 |
ggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||| |||||||||||||||||||||||| |||||||| | |||| ||||||||| |
|
|
T |
26547692 |
ggagcaaagccggcaacgacggaactctatcggtttattgtttttattatgttgtt |
26547747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 26551251 - 26551306
Alignment:
Q |
148 |
ggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||| |||||||||||||||||||||||| |||||||| | |||| ||||||||| |
|
|
T |
26551251 |
ggagcaaagccggcaacgacggaactctatcggtttattgtttttattatgttgtt |
26551306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 193
Target Start/End: Original strand, 43491372 - 43491411
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttcttta |
193 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
43491372 |
aagccggcaacgacggaactctatcggtttattttcttta |
43491411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 3194814 - 3194855
Alignment:
Q |
162 |
aacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||||||||| |
|
|
T |
3194814 |
aacgacggaattctatcggtttattttctttactatgttgtt |
3194855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 34653256 - 34653215
Alignment:
Q |
162 |
aacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||||||||| |
|
|
T |
34653256 |
aacgacggaattctatcggtttattttctttactatgttgtt |
34653215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 14376305 - 14376258
Alignment:
Q |
156 |
gccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||| ||||| ||||| ||||||||||||||||||||||||| |
|
|
T |
14376305 |
gccggcaacaacggatttctatcggtttattttctttactatgttgtt |
14376258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 32837645 - 32837694
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||| |||||| ||| ||||||||||||||||||||||||| |
|
|
T |
32837645 |
aagccggcaactacggaattctgacggtttattttctttactatgttgtt |
32837694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 40800276 - 40800244
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttatt |
186 |
Q |
|
|
|||||||||||||||||||||||| |||||||| |
|
|
T |
40800276 |
aagccggcaacgacggaactctatcggtttatt |
40800244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 40617187 - 40617143
Alignment:
Q |
159 |
ggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
40617187 |
ggcaacgacggaactctatcggtttattttctttactatgttgtt |
40617143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 19864984 - 19864935
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||| |||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
T |
19864984 |
aagccagcaacgacggaactctatcggtttattttctttactatcttgtt |
19864935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 5681058 - 5681102
Alignment:
Q |
159 |
ggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
T |
5681058 |
ggcaacgacggaactctatcggtttattttctttactatattgtt |
5681102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 27013892 - 27013936
Alignment:
Q |
159 |
ggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
T |
27013892 |
ggcaacgacggaactctatcgatttattttctttactatgttgtt |
27013936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 147 - 203
Target Start/End: Complemental strand, 37103720 - 37103664
Alignment:
Q |
147 |
aggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| |||||||||||| || |||||||| ||||||||||||||| ||||||||| |
|
|
T |
37103720 |
aggagcaaagccggcaacggcgaaactctatcggtttattttctttattatgttgtt |
37103664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 19860020 - 19859971
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||| || ||||||||||||||||||| ||||| |
|
|
T |
19860020 |
aagccggcaacgacggaacttcatcggtttattttctttactatattgtt |
19859971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 5672507 - 5672554
Alignment:
Q |
157 |
ccggcaacga-cggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||| ||||||||||| |||||||||||||| |||||||||| |
|
|
T |
5672507 |
ccggcaacgaacggaactctatcggtttattttctttgctatgttgtt |
5672554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 10385575 - 10385621
Alignment:
Q |
157 |
ccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
10385575 |
ccggcaacgacggaactctatgaatttattttttttactatgttgtt |
10385621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 5670198 - 5670235
Alignment:
Q |
166 |
acggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||| |||||||||||||| |||||||||| |
|
|
T |
5670198 |
acggaactctatcggtttattttctttgctatgttgtt |
5670235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 12237900 - 12237945
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||| | ||| ||||||||||||||| ||||||||| |
|
|
T |
12237900 |
cggcaacgacggaattttatcggtttattttctttattatgttgtt |
12237945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 203
Target Start/End: Complemental strand, 11703103 - 11703047
Alignment:
Q |
147 |
aggagctaagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| | |||| || ||||| || ||||| ||||||||||||||||||||||||| |
|
|
T |
11703103 |
aggagcaacgccgacatcgacgaaattctatcggtttattttctttactatgttgtt |
11703047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0381 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0381
Description:
Target: scaffold0381; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 5893 - 5848
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
T |
5893 |
cggcaacgacggaactctatcgatttattttctttactatgttgtt |
5848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 2092 - 2137
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
T |
2092 |
cggcaacgacggaactctatcggtttattttctttattatgttgtt |
2137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 200
Target Start/End: Original strand, 5922 - 5963
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgtt |
200 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||||||||| |
|
|
T |
5922 |
cggcaacgacggaactctatcggtttatttt-tttactatgtt |
5963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: scaffold0214
Description:
Target: scaffold0214; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 13215 - 13264
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||| | |||||| ||||||||||||||||||||||||| |
|
|
T |
13215 |
aagccggcaacgacgaagctctatcggtttattttctttactatgttgtt |
13264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 19665 - 19714
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||| | |||||| ||||||||||||||||||||||||| |
|
|
T |
19665 |
aagccggcaacgacgaagctctatcggtttattttctttactatgttgtt |
19714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 27231 - 27280
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
||||||||||||||| | |||||| ||||||||||||||||||||||||| |
|
|
T |
27231 |
aagccggcaacgacgaagctctatcggtttattttctttactatgttgtt |
27280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 53387 - 53345
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
53387 |
caacgacgaaactctatcggtttattttctttactatgttgtt |
53345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 68286 - 68244
Alignment:
Q |
161 |
caacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
68286 |
caacgacgaaactctatcggtttattttctttactatgttgtt |
68244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 62145 - 62190
Alignment:
Q |
158 |
cggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||||||||||||||||| || ||||||||||||| |||||||| |
|
|
T |
62145 |
cggcaacgacggaactctatcgggttattttctttaccatgttgtt |
62190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 226961 - 227010
Alignment:
Q |
154 |
aagccggcaacgacggaactctattggtttattttctttactatgttgtt |
203 |
Q |
|
|
|||||| |||||||| | |||||| ||||||||||||||||||||||||| |
|
|
T |
226961 |
aagccgacaacgacgaagctctatcggtttattttctttactatgttgtt |
227010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University