View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_206 (Length: 202)
Name: NF0583_low_206
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_206 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 3e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 38 - 113
Target Start/End: Original strand, 24036575 - 24036650
Alignment:
Q |
38 |
ataatttcacacttttgtggttctctcatgcagtttcatttcatcattcttttcttctaattaatgcaactttggc |
113 |
Q |
|
|
|||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24036575 |
ataatttcacacttttctggtgctctcatgcggtttcatttcatcattcttttcttctaattaatgcaactttggc |
24036650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 515 times since January 2019
Visitors: 3835