View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_36 (Length: 464)
Name: NF0583_low_36
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 155 - 367
Target Start/End: Original strand, 34478112 - 34478320
Alignment:
| Q |
155 |
agcagagaggagaagaagggagagaataaatggtcaccttggaacattacgtggtcttgtggcttccactcatcaaaaggtatgttttgttccttctttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34478112 |
agcagagaggagaagaagggagagaataaatggtcaccttggaacattacgtggtcttgtggcttccactcatcaaaaggtatgttttgttccttctttt |
34478211 |
T |
|
| Q |
255 |
tgttgtcagttttataatttcattctaattgtaagattggtttagaattttatcaatatattatatttgaaaagttatgattaattaaaatagcagattc |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
34478212 |
tgttgtcagttttataatttcattctaattgtaagattggtttagaattttatcaatatattatatttgaaaagttatg----attaaaatagcggattc |
34478307 |
T |
|
| Q |
355 |
ttgcgtaaaaagt |
367 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34478308 |
ttgcgtaaaaagt |
34478320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 34478295 - 34478234
Alignment:
| Q |
13 |
ttaatcataacgattcaaatataaaatatagataaaattctaaaccaagcctacaatgagaa |
74 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||||||||||| | |||||| |||| |
|
|
| T |
34478295 |
ttaatcataacttttcaaatataatatattgataaaattctaaaccaatcttacaattagaa |
34478234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1206 times since January 2019
Visitors: 3841