View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_61 (Length: 405)
Name: NF0583_low_61
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 131 - 377
Target Start/End: Original strand, 12678322 - 12678568
Alignment:
Q |
131 |
catatttggacttttcttgcattacaaacaaacagccattacataaagttttatgattattttcctaatcaaagtagaaaggggtttagacttagaatgt |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
12678322 |
catatttggacttttcttgcattacaaacaaacagccattacataaagttttatgattattttcctaatcaaagtggaaaggggtttagacttagaatgt |
12678421 |
T |
 |
Q |
231 |
attgtatgcaagtgatcttgaagaagtaaacattgatttattcacttatttgcatatgaatggtaatttagnnnnnnnnnnnnnnnntatctgtgtcctt |
330 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
12678422 |
attgtatgcaagtgatcttgaagaagtaaacattgatttattcacttatttgcatatgaatggtaatttagaaaaaataaaataaaatatctgtgtcctt |
12678521 |
T |
 |
Q |
331 |
gaatcggcgtgcgcaagatggaccatggtttgagagggtttatttct |
377 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12678522 |
gaatcggcgtgcgcaagatggaccatggtttgagagggtttatttct |
12678568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 61 - 112
Target Start/End: Original strand, 12678238 - 12678289
Alignment:
Q |
61 |
tttactatgattattgtcatgcattcttttgtccggtgttgtttttcttcac |
112 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
12678238 |
tttactatgattattgttatgcattcttttgtccggtgttgtttttcttcac |
12678289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 93 times since January 2019
Visitors: 3832