View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_62 (Length: 403)
Name: NF0583_low_62
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 3 - 157
Target Start/End: Complemental strand, 5759399 - 5759245
Alignment:
| Q |
3 |
cataggaaggttaaagagatcatatgaggcttatagttttaccttcatcatcaatcttcttctaaaatatgagtctcccacatcctttacttgtatcacc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5759399 |
cataggaaggttaaagagatcatatgaggcttatcgttttaccttcatcatcaatcttcttctaaaatatgagtctcccacatcctttacttgcatcacc |
5759300 |
T |
 |
| Q |
103 |
attacaaccaacaaaatgcgtcttctaactccataccttgttcactctttccttt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5759299 |
attacaaccaacaaaatgcgtcttctaactccatcccttgttcactctttccttt |
5759245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 245 - 397
Target Start/End: Complemental strand, 5759157 - 5759006
Alignment:
| Q |
245 |
ggtgtcatgttagggtgaagaaaagctccttccaaagaatagaacaatcagtaaaggaaaatcagacagattaaaaaatctttcatgatagtcatggata |
344 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5759157 |
ggtgtcatgttagggtgaagaaa-gctccttccaaagaatagaacaatcagtaaaggaaattcagaccgattaaaaaatctttcatgatagtcatggata |
5759059 |
T |
 |
| Q |
345 |
atttcgaacagaactaagtactaaaaattgttatctatatctcaacacctatg |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5759058 |
atttcgaacagaactaagtactaaaaattgttatctatatctcaacacctatg |
5759006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University