View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_67 (Length: 378)
Name: NF0583_low_67
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 3 - 232
Target Start/End: Complemental strand, 10194331 - 10194107
Alignment:
| Q |
3 |
ttttcttgtcaattataatttgcgatttatgatcaaacactgttaggcggcatgttcagtaacagatgagttcgaattccttgatcctgatatcaggatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10194331 |
ttttcttgtcaattataatttgcgatttatgatcaaacactgttaggctgcatgttcagtaacagatgagttcgaattccttgatcctgatatcaggatg |
10194232 |
T |
|
| Q |
103 |
cctggaatggtgttagggacagaaaattttgataagttccatgttgcagtgaatgcaattgatgcgatgcagtttatgacaaattgcaataccagattat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
10194231 |
cctggaatggtgttagggacagaaaattttgataagttccatgttgcagtgaatgcaattgattc-----agtttatgacaaattgcaataccagattat |
10194137 |
T |
|
| Q |
203 |
gtactactggtataaggttatagaacacat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10194136 |
gtactactggtataaggttatagaacacat |
10194107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 606 times since January 2019
Visitors: 3836