View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_72 (Length: 367)
Name: NF0583_low_72
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_72 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 29 - 354
Target Start/End: Complemental strand, 19906 - 19582
Alignment:
| Q |
29 |
aggatctacggatctattattgttcttttggtacaagcacgctgaaccttaatattgaaaatgacttaatgccttctcttcattttaactggggatattt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19906 |
aggatctacggatctattattgttcttttggtacaagcacgctgaaccttaatattgaaaatgacttaatgccttctcttcattttaactggggatattt |
19807 |
T |
 |
| Q |
129 |
gtgatacaactatgcatgcttgactttgtcaatagtcataaatagttgaatttgcgcgcgtcttcatttagaacaagaagattgtgctcaagattttata |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19806 |
gtgatacaactatgcatgcttgactttgtcaatagtcataaatagttgaatttgcgcgcgtcttcatttagaacaagaagattgtgctcaagattttata |
19707 |
T |
 |
| Q |
229 |
gacacttgatatttccgtttgatcatggtttctacatttactcttttttgccaggaggatatataatgatgagccttcagtattggggcttttacttgtt |
328 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
19706 |
gacgcttgatatttccatttgatcatggtttctacatttactct-ttttgccaggaggatatataatgatgaaccttcagtattggtgcttttacttgtt |
19608 |
T |
 |
| Q |
329 |
caacattgaaatattaatattggtct |
354 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
19607 |
caacattgaaatattaatattggtct |
19582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University