View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_74 (Length: 364)
Name: NF0583_low_74
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 271
Target Start/End: Complemental strand, 54416217 - 54415956
Alignment:
| Q |
10 |
aataatatggatgtgggtttcatgagtaattcatatgctagtgatccgtaataagagtataaaaatcaaagggaagcaaagtaacaagtaaaatttgatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54416217 |
aataatatggatgtgggtttcatgagtaattcatatgctagtgatccataataagagtataaaaatcaaagggaagcaaagtaacaagtaaaatttgatg |
54416118 |
T |
|
| Q |
110 |
ttaatcactcgaaaattaccgctggatgtgtggaaggggagtagggagcctgtgtttaccttatatagcttataagcccacagccaataacaattcataa |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54416117 |
ttaatcactcgtaaattaccgctggatgtgtggaaggggagtagggagcctgtgtttaccttatatagcttataagcccacagccaataacaattcataa |
54416018 |
T |
|
| Q |
210 |
ctaactgactggagttagcagctgtattgtcaatacagtattgacaggagcactggatgtgc |
271 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54416017 |
ctaactgactggagttggcagctgtattgtcaatacagtattgacaggagcactggatgtgc |
54415956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 140 times since January 2019
Visitors: 3831