View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_76 (Length: 364)
Name: NF0583_low_76
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 98 - 315
Target Start/End: Complemental strand, 39824807 - 39824590
Alignment:
| Q |
98 |
aaaccatggttcccaacatccaaagctttaactacctttggtgacacaaactgcatggaacagttacttgttcattgcgcaaacgcaatcgaaacaaacg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824807 |
aaaccatggttcccaacatccaaagctttaactacctttggagacacaaactgcatggaacagttacttgttcattgcgcaaacgcaatcgaaacaaacg |
39824708 |
T |
 |
| Q |
198 |
atgtaacacttgctcaacaaatcctttgggttctcaataacatagcaccacaagacggtgattcaaatcaacgcttagcttatagtttccttagagccct |
297 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824707 |
atgtaacacttgctcagcaaatcctttgggttctcaataacatagcaccacaagacggtgattcaaatcaacgcttagcttatagtttccttagagccct |
39824608 |
T |
 |
| Q |
298 |
cacaaatcgtgcagtgaa |
315 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39824607 |
cacaaatcgtgcagtgaa |
39824590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University