View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_89 (Length: 339)
Name: NF0583_low_89
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_89 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 89 - 267
Target Start/End: Complemental strand, 52076122 - 52075944
Alignment:
Q |
89 |
ggaggaacatgattccaatcatgagttggtgaaatttcagaaggataaggttagggatcagattgagagtgttgttgtcgttgattatgtggtgccgccg |
188 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52076122 |
ggaggaacatgattccaatcatgagttgatgaaatttcagaaggataaggttagggatcagattgagagtgttgttgtcgttgattatgtggtgccgccg |
52076023 |
T |
 |
Q |
189 |
ccaccacctcctcaatcggcaagtctttgatgaaggttatttctgtttgatcattgcttttgaatttttcacttctgtg |
267 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52076022 |
ccaccacctcctcaatcggcaagtctttgatgaaggttatttctgtttgatcattgcttttgaatttttcacttctgtg |
52075944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 944 times since January 2019
Visitors: 3838