View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_95 (Length: 324)
Name: NF0583_low_95
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_95 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 17 - 324
Target Start/End: Complemental strand, 14787394 - 14787086
Alignment:
| Q |
17 |
tgtgggaggtcatatattgaggaagatgtttctaggatattattttaatggttataggtacttatgatatgaaattatgaacttagtttttattaaccat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14787394 |
tgtgggaggtcatatattgaggaagatgtttctaggatattattttaatggttataggtacttatgatatgaaattatgaacttagtttttattaaccat |
14787295 |
T |
 |
| Q |
117 |
gtgaaaatctgacaaatgttta-gtatttctttggtgccattgtactacttcatggtttaagagtgacatagatttcaactatttaatatatgttgccat |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14787294 |
gtgaaaatctgacaaatgtttaagtatttctttggtgccattgtactacttcatggtttaagagtgacatagatttcaactatttaatatatgttgccat |
14787195 |
T |
 |
| Q |
216 |
gttagttttgttgttatcacgattcttatcgcagtctatggaaatggtaggtatcaatgatagcgagatacataattatcagataaatctgaaagaaagt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14787194 |
gttagttttgttgttatcacgattcttatcgcagtctatggaaatggtaggtatcaatgatagcgagatacataattatcagataaatctgaaagaaagt |
14787095 |
T |
 |
| Q |
316 |
ggttcctcc |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
14787094 |
ggttcctcc |
14787086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University