View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584-Insertion-3 (Length: 101)
Name: NF0584-Insertion-3
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0584-Insertion-3 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 7 - 101
Target Start/End: Original strand, 23985439 - 23985533
Alignment:
Q |
7 |
agtaatatgatagtgatttagaagaccatgaagttcatgtcaaatcctagagttcaactggcttaattagcttagaaatactttcatcccatcgt |
101 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
23985439 |
agtaatataatagtgatttagaagaccatgaagttcatgtcaaatcctagagttcaactggcttaattagcttagaaaaactttcatcccatcgt |
23985533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University