View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584-Insertion-4 (Length: 45)
Name: NF0584-Insertion-4
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0584-Insertion-4 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 37219259 - 37219222
Alignment:
Q |
8 |
gcctcaattacacagcctcatttttcaaatatgctatg |
45 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
37219259 |
gcctcaattacacagcctcatttttcaaatatgctatg |
37219222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University