View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0584-Insertion-4 (Length: 45)

Name: NF0584-Insertion-4
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0584-Insertion-4
NF0584-Insertion-4
[»] chr1 (1 HSPs)
chr1 (8-45)||(37219222-37219259)


Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 37219259 - 37219222
Alignment:
Q  8 gcctcaattacacagcctcatttttcaaatatgctatg 45  Q
    ||||||||||||||||||||||||||||||||||||||    
T  37219259 gcctcaattacacagcctcatttttcaaatatgctatg 37219222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University