View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0584_high_16 (Length: 245)

Name: NF0584_high_16
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0584_high_16
NF0584_high_16
[»] chr8 (2 HSPs)
chr8 (80-178)||(5410640-5410738)
chr8 (11-108)||(5410473-5410570)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 80 - 178
Target Start/End: Original strand, 5410640 - 5410738
Alignment:
80 atacagttagattcatgattgaaatgggactatcagcaacttgtcccatgattatcaatatcattgattaatgggacccttgaactcaaactactatat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5410640 atacagttagattcatgattgaaatgggactatcagcaacttgtcccatgattatcaatatcattgattaatgggacccttgaactcaaactactatat 5410738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 11 - 108
Target Start/End: Original strand, 5410473 - 5410570
Alignment:
11 caaagggataggttcaaagtacaactttgtagaagaacgaatcagagtaaacggggaatcaagaatctgatacagttagattcatgattgaaatggga 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5410473 caaagggataggttcaaagtacaactttgtagaagaacgaatcagagtaaacggggaatcaagaatctgatacagttagattcatgattgaaatggga 5410570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 612 times since January 2019
Visitors: 3836