View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_high_16 (Length: 245)
Name: NF0584_high_16
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 80 - 178
Target Start/End: Original strand, 5410640 - 5410738
Alignment:
| Q |
80 |
atacagttagattcatgattgaaatgggactatcagcaacttgtcccatgattatcaatatcattgattaatgggacccttgaactcaaactactatat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5410640 |
atacagttagattcatgattgaaatgggactatcagcaacttgtcccatgattatcaatatcattgattaatgggacccttgaactcaaactactatat |
5410738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 11 - 108
Target Start/End: Original strand, 5410473 - 5410570
Alignment:
| Q |
11 |
caaagggataggttcaaagtacaactttgtagaagaacgaatcagagtaaacggggaatcaagaatctgatacagttagattcatgattgaaatggga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5410473 |
caaagggataggttcaaagtacaactttgtagaagaacgaatcagagtaaacggggaatcaagaatctgatacagttagattcatgattgaaatggga |
5410570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University