View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_10 (Length: 425)
Name: NF0584_low_10
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 30 - 413
Target Start/End: Original strand, 23075739 - 23076122
Alignment:
| Q |
30 |
ccatgaacttggttgttgaatcttcaaagctgacaatggatattgggggtaaccccacaatctatttgtgagctacatccnnnnnnnnncctacaaacat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23075739 |
ccatgaacttggttgttgaatcttcaaagctgacaatggatattgggggtaaccccacaatctatttgtgagctacatccttcttttttcctacaaacat |
23075838 |
T |
 |
| Q |
130 |
tttgcagcatagagcattgtttccactttccacatttgggtttggaaggtggaaatgtgaatttgggggtcactttgtgtcgttgtatgactcgagggtt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075839 |
tttgcagcatagagcattgtttccactttccacatttgggtttggaaggtggaaatgtgaatttgggggtcactttgtgtcgttgtatgactcgagggtt |
23075938 |
T |
 |
| Q |
230 |
ggctcacgaaagtgatgaagaatgaaaatattttgaatttctttagagaaaggttaaaacaccttgggaaataatttggttgtctccaccctctgtgtct |
329 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075939 |
ggctcgcgaaagtgatgaagaatgaaaatattttgaatttctttagagaaaggttaaaacaccttgggaaataatttggttgtctccaccctctgtgtct |
23076038 |
T |
 |
| Q |
330 |
agttatggaggttctccatttcttgccccaactcgctccctccctatatctttctctcgatgttctatttgtttataggtttca |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23076039 |
agttatggaggttctccatttcttgccccaactcgctccctccctatatctttctctcaatgttctatttgtttataggtttca |
23076122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University