View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_15 (Length: 420)
Name: NF0584_low_15
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0584_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 136 - 409
Target Start/End: Complemental strand, 17577423 - 17577149
Alignment:
Q |
136 |
aggtagatgaaagtagtgaatttctaccattggtgtatgatccagctagtattactgcatattggggaaaacgtcctcgctccgttgcaactcgcattgt |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17577423 |
aggtagatgaaagtagtgaatttctaccattggtgtatgatccagctagtattactgcatattggggaaaacgtcctcgctccgttgcaactcgcattgt |
17577324 |
T |
 |
Q |
236 |
gcagttattatctgttgctggaggttttctttcgcgggttgcgtgggatgtggttaacaagaaggttaaagaggtaatttttctatgtccagat-agact |
334 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
17577323 |
gcagttattatctgttgctggaggttttctttcgcgggttgcgtgggatgtggttaacaagaaggttaaagaggtaatttttctatgtccagataagact |
17577224 |
T |
 |
Q |
335 |
aagcagcttgcgtgcattcttgacatggtggtcattgtcggtggnnnnnnnattctcccttgctttctgtttctt |
409 |
Q |
|
|
||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
T |
17577223 |
aagcagcttgcgtgcattcctgacatggtggttattgtcggtggtttttttattctcccttgctttctgtttctt |
17577149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 17577551 - 17577483
Alignment:
Q |
1 |
ttttcttcataaatatatgacatttccatttatgatgcttgaatattcacgagcactagcatcgagcta |
69 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
17577551 |
ttttcttcataaatatatgacatttccatttatgatgcttgaatattcacgagcattagcatcgagcta |
17577483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2823 times since January 2019
Visitors: 3829