View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_20 (Length: 327)
Name: NF0584_low_20
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 91 - 313
Target Start/End: Complemental strand, 1885462 - 1885240
Alignment:
| Q |
91 |
attatttttatcatcatcatcaaatgaaatttgtgtttgcggcttttaattagttgttcttttgaaatttatcatcatcatcatcaaataacctcagctt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885462 |
attatttttatcatcatcatcaaatgaaatttgtgtttgcggcttttaattagttgttcttttgaaatttatcatcatcatcatcaaataacctcagctt |
1885363 |
T |
|
| Q |
191 |
atggtttcgtgtttcaaatgaaataaatagtatattacaaggtgaaagaaatagatacgatagacatcatgttctgtccaattctacctacgaagacata |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885362 |
atggtttcgtgtttcaaatgaaataaatagtatattacaaggtgaaagaaatagatacgatagacatcatgttctgtccaattctacctacgaagacata |
1885263 |
T |
|
| Q |
291 |
ccggactctacaacattgcaaca |
313 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1885262 |
ccggactctacaacattgcaaca |
1885240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 154 times since January 2019
Visitors: 3831