View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_22 (Length: 296)
Name: NF0584_low_22
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 58 - 212
Target Start/End: Original strand, 33805475 - 33805629
Alignment:
| Q |
58 |
agagatcttgagttcgaattagactgagacactatcttgagttagaagtatattgatatatttgaaattttagtttacaaatggatgcacatcgaattca |
157 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33805475 |
agagatcttaagttcgaattagactgagacactatcttgagttagaagcatattgatatatttgaaattttagtttacaaatggatgcacatcgaattca |
33805574 |
T |
 |
| Q |
158 |
cgacagtagtttctcttgtacattgaatcagttgatgtaattagtgactaataag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33805575 |
cgacagtagtttctcttgtacattgaatcagttgatgtaattagtgactaataag |
33805629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University