View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_32 (Length: 253)
Name: NF0584_low_32
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0584_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 10981032 - 10980808
Alignment:
Q |
1 |
aaataaatcaaactacttcttaaagctgtaagttattttcataaactatactatagctcacgaaaataagctaaaaacaggttatgtacgacagtacgtg |
100 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
T |
10981032 |
aaataaatcaaactacttcttaaagctataagttattttcataaactatactatagctcacgaaaagaagctaaaaacaggttatgtacgacaatacgtg |
10980933 |
T |
 |
Q |
101 |
tcatatgctggttttgtaagctctctctcaaacaatctcataaatgcacatggcaattgaaaaattcaaataaaccaatctaaacatgccataagcctca |
200 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10980932 |
tcatatgctgcttttgtaagctctctctcaaacaatctcataaatgcacatggcaatggaaaaattcaaataaaccaatctaaacatgccataagcctca |
10980833 |
T |
 |
Q |
201 |
aaccggtgattagtcctatagtcgg |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
10980832 |
aaccggtgattagtcctatagtcgg |
10980808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2340 times since January 2019
Visitors: 3818