View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_36 (Length: 248)
Name: NF0584_low_36
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_low_36 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 44693353 - 44693112
Alignment:
| Q |
8 |
cagcacagaacatccagcaccactgagacggaatcaaccccgaaaaccagacaaccagcgaaggaaaaccagacagaaaacgataccttcagcagacaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44693353 |
cagcacagaacatccagcaccactgagacggaatcaaccccgaaaaccagacaactagcgaaggaaaaccagacagaaaacgataccttcagcagacaaa |
44693254 |
T |
|
| Q |
108 |
ccaaacagcacaaaaacaactatctcaatagacacaacttcggattccaacttcactcataataaaggcaggccggtatattaaggcgggataggcacca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
44693253 |
ccaaacagcacaaaaacaactatctcaatagacacaacttcggattccaacttcactcataataaaggcaggccggtatcttaaggctggataggcacca |
44693154 |
T |
|
| Q |
208 |
cctccacgataaaactttaacct-ctcaatgatttccaacac |
248 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
44693153 |
cctccacgataaaactttaacctcctcaacgatttccaacac |
44693112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 370 times since January 2019
Visitors: 3833