View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0584_low_39 (Length: 236)

Name: NF0584_low_39
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0584_low_39
NF0584_low_39
[»] chr8 (2 HSPs)
chr8 (31-85)||(4580272-4580326)
chr8 (108-154)||(4580345-4580391)


Alignment Details
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 4580272 - 4580326
Alignment:
31 aattccatcttgatgtttgatcattatcaggtttaggggatttgttatattgaag 85  Q
    ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||    
4580272 aattccatcttgatgtttgatcattataaggtttaggggatgtgttatattgaag 4580326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 4580345 - 4580391
Alignment:
108 aaggaatgttatattgaagtttttgatactgtatttgatattattgg 154  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||    
4580345 aaggaatgttatattgaagtttttgatactgtatttgatatttttgg 4580391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University