View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_40 (Length: 234)
Name: NF0584_low_40
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0584_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 8534504 - 8534598
Alignment:
Q |
1 |
aagtttctcttgtctcttgttctttaccgaacctagccattacaacttgaaccatcgctattagattcttgtgggaagatactactcctttgctt |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8534504 |
aagtttctcttgtctcttgttctttaccgaacctagccattacaacttgaaccatcgctattagattcttgtgggaagatactactcctttgctt |
8534598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 8599743 - 8599837
Alignment:
Q |
1 |
aagtttctcttgtctcttgttctttaccgaacctagccattacaacttgaaccatcgctattagattcttgtgggaagatactactcctttgctt |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8599743 |
aagtttctcttgtctcttgttctttaccgaacctagccattacaacttgaaccatcgctattagattcttgtgggaagatactactcctttgctt |
8599837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 8613683 - 8613589
Alignment:
Q |
1 |
aagtttctcttgtctcttgttctttaccgaacctagccattacaacttgaaccatcgctattagattcttgtgggaagatactactcctttgctt |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8613683 |
aagtttctcttgtctcttgttctttaccgaacctagccattacaacttgaaccatcgctattagattcttgtgggaagatactactcctttgctt |
8613589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 705 times since January 2019
Visitors: 3837