View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_43 (Length: 209)
Name: NF0584_low_43
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 12 - 189
Target Start/End: Original strand, 16348204 - 16348381
Alignment:
| Q |
12 |
acagagagaatcctttctgggttttcgcgcgtggagcataaaccatgaatgagcatgtctcacgcgccaaatggggtgtgtggattttgcatcatgaatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16348204 |
acagagagaatcctttctgggttttcgcgcgtggagcataaaccatgaatgagcatgtcccacgcgccaaatggggtgtgtggattttgcatcatgaatt |
16348303 |
T |
 |
| Q |
112 |
gttctgcttggttgaaactgtgtgaattgagaagtgcccatgtgaggattttgtgggatttgtgagggatttggattt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
16348304 |
gttctgcttggttgaaactgtgtgaattgagaagtgcccatgtgaggattttgtgagttttgtgagggatttggattt |
16348381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 14 - 125
Target Start/End: Complemental strand, 47916875 - 47916760
Alignment:
| Q |
14 |
agagagaatcctttctgggttttcgcgcgt----ggagcataaaccatgaatgagcatgtctcacgcgccaaatggggtgtgtggattttgcatcatgaa |
109 |
Q |
| |
|
||||| ||||||||||||||||| || ||| | ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47916875 |
agagataatcctttctgggttttggcacgtagaggcagcataaaccatgaatgagcatgtcccacgcgcgaaatggggtgtgtggattttgcatcatgaa |
47916776 |
T |
 |
| Q |
110 |
ttgttctgcttggttg |
125 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
47916775 |
tttttctgcttggttg |
47916760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University