View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_44 (Length: 206)
Name: NF0584_low_44
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 32396414 - 32396515
Alignment:
| Q |
1 |
ttgttttgcctccaagccttactttaatatgatagaaaatttcaggattagcaatttatatggccaccttcaagcctaagtttgattagaaatggtacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32396414 |
ttgttttgcctccaagccttactttaatatgatagaaaatttcaggattagcaatttatatggccaccttcaagcctaagtttgattagaaatggtacaa |
32396513 |
T |
|
| Q |
101 |
ct |
102 |
Q |
| |
|
|| |
|
|
| T |
32396514 |
ct |
32396515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 59 times since January 2019
Visitors: 3832