View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0584_low_6 (Length: 516)
Name: NF0584_low_6
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0584_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 4e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 4e-98
Query Start/End: Original strand, 30 - 219
Target Start/End: Original strand, 32790327 - 32790516
Alignment:
| Q |
30 |
catattgatttatttgagtttatcgactgacatgaacacttgtatgtatatcaacatcgtgcaaaaagactggaaaattaaacaggtaaataagaaataa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32790327 |
catattgatttatttgagtttatcgactgacatgaacacttgtatgtatatcaacatcgtgcaaaaagactggaaaattaaacaggcaaataagaaataa |
32790426 |
T |
|
| Q |
130 |
cctgtcgcccttcggtttcctcatgcgatcgccattagctttggatacagcatcaatttcagctcgaatttgacgcatctaggattgtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32790427 |
cctgtcgcccttcggtttcctcatgcgatcgccattagctttggatacagcaccaatttcagctcgaatttgacgcatctaggattgtat |
32790516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 284 - 489
Target Start/End: Original strand, 32790584 - 32790783
Alignment:
| Q |
284 |
gtagtacctacttccatgggtctgcgactgcgaccatccaagcgaagtccttctgggctcacgtattccattttttggttttcaaattcaaataaatttg |
383 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||| |
|
|
| T |
32790584 |
gtagtacctacttccatgggtctgc------gaccatccaagcgaagtccttctgggctcacgtattccattttttggtgttcaaattcaaaaaaaattg |
32790677 |
T |
|
| Q |
384 |
tgaaggcattgttgttttgcgatactttgtcctttgcttcaaccgcggcgcttaagcgcgcaattctggaatttgacctctttttgtctttagggaagaa |
483 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32790678 |
tgaaggcaatgttgttttgcgatactttgtcctttgcttcaaccgcggcgcttaagcgcgcaatcctggaatttgaactctttttgtctttagggaagaa |
32790777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 4e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 90 - 159
Target Start/End: Original strand, 48283665 - 48283734
Alignment:
| Q |
90 |
gcaaaaagactggaaaattaaacaggtaaataagaaataacctgtcgcccttcggtttcctcatgcgatc |
159 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48283665 |
gcaaaaagactgggaaattaaacaagtaaataagaaataacctgtcgccctttggtttcctcatgcgatc |
48283734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 161 - 216
Target Start/End: Original strand, 48284253 - 48284308
Alignment:
| Q |
161 |
ccattagctttggatacagcatcaatttcagctcgaatttgacgcatctaggattg |
216 |
Q |
| |
|
|||| |||||||||||||||| |||| || ||||||||||| |||||||||||||| |
|
|
| T |
48284253 |
ccatcagctttggatacagcaccaatctctgctcgaatttgtcgcatctaggattg |
48284308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2809 times since January 2019
Visitors: 3829