View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0585_low_11 (Length: 315)
Name: NF0585_low_11
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0585_low_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 24 - 315
Target Start/End: Complemental strand, 1242248 - 1241957
Alignment:
| Q |
24 |
caatacacctgcttctgctcgatatggtactagtgtcacaatctacacaagttacaactttgtcacacgaatgctgcattaatttcctactttttctttt |
123 |
Q |
| |
|
|||| |||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1242248 |
caatccacctggtcctgctcgatctggtactagtgtcacaatctacacaagttacaactttgtcacacgaatgctgcattaatttcctactttttctttt |
1242149 |
T |
|
| Q |
124 |
tctattgcatatattttgaagtgtatattgcagaaaataatcaattgagtgattgatatcaattggttaataaacttaagataagatttaaagacaaatc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1242148 |
tctattgcatatattttgaagtgtttattgcagaaaataatcaattcattgattgatatcaattggttaataaacttaagataagatttaaagacaaatc |
1242049 |
T |
|
| Q |
224 |
gatggggataattaaagtttaaatctttaccgaaactattactggtcaacatttatttacactgctactgaattctaaattatgaggttaat |
315 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| | ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1242048 |
gatggggataattaaagtttaaatcattaccgaaacaattattagtcaacatttatttacattgctactgaattctaaattatgaggttaat |
1241957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 795 times since January 2019
Visitors: 3837