View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0585_low_12 (Length: 315)
Name: NF0585_low_12
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0585_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 127 - 239
Target Start/End: Original strand, 961865 - 961977
Alignment:
| Q |
127 |
cttaggaccaagttgtatgatacttgtaacttaactgaccgaaatgaaagaaaacatacttaaaggaacaaaaatgtaatttaactattaatatgaaatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
961865 |
cttaggaccaagttgtatgatacttgtaacttaactgaccgaaatgaaagaaaacatacttaaaggaacaaaaatgtaatttaactattaatatgaaacg |
961964 |
T |
|
| Q |
227 |
aaagaagtattat |
239 |
Q |
| |
|
||||||||||||| |
|
|
| T |
961965 |
aaagaagtattat |
961977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 461 times since January 2019
Visitors: 3834