View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0585_low_13 (Length: 314)
Name: NF0585_low_13
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0585_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 75 - 222
Target Start/End: Original strand, 26112800 - 26112948
Alignment:
| Q |
75 |
acagaaaattttgtagaaaagttaatagaaaagccacccaaaggaaggnnnnnnnnn-gattagataatatgtaatcattgttaatttggtaaataatct |
173 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26112800 |
acagaaaattttgtagaaaagttaattgaaaatctacccaaaggaaggaaaaaaaaaagattagataatatgtaatcattgttaatttggtaaataatct |
26112899 |
T |
 |
| Q |
174 |
tcttagcttccactgtctaaatcactcttgtgacaactaacctagtatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26112900 |
tcttagcttccactgtctaaatcactcttgtgacaactaacctagtatg |
26112948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University