View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0585_low_13 (Length: 314)

Name: NF0585_low_13
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0585_low_13
NF0585_low_13
[»] chr1 (1 HSPs)
chr1 (75-222)||(26112800-26112948)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 75 - 222
Target Start/End: Original strand, 26112800 - 26112948
Alignment:
75 acagaaaattttgtagaaaagttaatagaaaagccacccaaaggaaggnnnnnnnnn-gattagataatatgtaatcattgttaatttggtaaataatct 173  Q
    |||||||||||||||||||||||||| ||||| | |||||||||||||          ||||||||||||||||||||||||||||||||||||||||||    
26112800 acagaaaattttgtagaaaagttaattgaaaatctacccaaaggaaggaaaaaaaaaagattagataatatgtaatcattgttaatttggtaaataatct 26112899  T
174 tcttagcttccactgtctaaatcactcttgtgacaactaacctagtatg 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
26112900 tcttagcttccactgtctaaatcactcttgtgacaactaacctagtatg 26112948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University