View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0585_low_15 (Length: 309)
Name: NF0585_low_15
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0585_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 30 - 263
Target Start/End: Complemental strand, 24462129 - 24461897
Alignment:
| Q |
30 |
atgagttggggagagttttggctgaggccattggtgggagtggagaggaaataagtagggctttgaaactgaagcaagcagcgtttgatgctgttagaga |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24462129 |
atgagttggggagagttttggctgaggccattggtgggagtggagaggaaataagtaggtctttgaaactgaagcaagcagcgtttgatgctgttagaga |
24462030 |
T |
|
| Q |
130 |
aggtggaagttctgataaggatttgcaatgcttgatggaacaacttgtattgtaattttagaatgtacttttggttttgagttgaaagaatataaaatca |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24462029 |
aggtggaagttctgataaggatttacaatgcttgatggaacaacttgtattgtaattttagaatgtacttttggttttgagttgaaagaatataaaatca |
24461930 |
T |
|
| Q |
230 |
aaggtgataataatttgtaccaacttgtgtaata |
263 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |
|
|
| T |
24461929 |
aaggtgataataatttgtaccgac-tgtgtaata |
24461897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 374 times since January 2019
Visitors: 3833