View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0585_low_16 (Length: 309)

Name: NF0585_low_16
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0585_low_16
NF0585_low_16
[»] chr2 (1 HSPs)
chr2 (30-263)||(24461897-24462129)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 30 - 263
Target Start/End: Complemental strand, 24462129 - 24461897
Alignment:
30 atgagttggggagagttttggctgaggccattggtgggagtggagaggaaataagtagggctttgaaactgaagcaagcagcgtttgatgctgttagaga 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
24462129 atgagttggggagagttttggctgaggccattggtgggagtggagaggaaataagtaggtctttgaaactgaagcaagcagcgtttgatgctgttagaga 24462030  T
130 aggtggaagttctgataaggatttgcaatgcttgatggaacaacttgtattgtaattttagaatgtacttttggttttgagttgaaagaatataaaatca 229  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24462029 aggtggaagttctgataaggatttacaatgcttgatggaacaacttgtattgtaattttagaatgtacttttggttttgagttgaaagaatataaaatca 24461930  T
230 aaggtgataataatttgtaccaacttgtgtaata 263  Q
    ||||||||||||||||||||| || |||||||||    
24461929 aaggtgataataatttgtaccgac-tgtgtaata 24461897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University