View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0585_low_20 (Length: 274)
Name: NF0585_low_20
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0585_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 31 - 233
Target Start/End: Original strand, 16190411 - 16190613
Alignment:
| Q |
31 |
gagcacagagcacagcataaaaacagagcacagaaggtgtttnnnnnnnnnncagagcacagagacagttggtgcatacaagaaaggaacagagagaaga |
130 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16190411 |
gagcacagagtacagcataaaaacagagcacggagggtgtttaaaaaataaacagagcacagagacagttggttcatacaagaaaggaacagagagaaga |
16190510 |
T |
|
| Q |
131 |
gaaaaattacatactttgtatctccagcttctacatcagctcagcaaaccagaaggaaattggtcctggttgaccagatcaataagtcgatgcaccacag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16190511 |
gaaaaattacatactttgtatctccagcttctacatcagctcagcaaaccagaaggaaattggtcctggttgaccagatcaataagtcgatgcaccacag |
16190610 |
T |
|
| Q |
231 |
gtt |
233 |
Q |
| |
|
||| |
|
|
| T |
16190611 |
gtt |
16190613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 834 times since January 2019
Visitors: 3837