View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0585_low_22 (Length: 271)
Name: NF0585_low_22
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0585_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 165
Target Start/End: Original strand, 4149557 - 4149710
Alignment:
| Q |
12 |
taatattgggcactttcttccaaagctctctatcttcaggcttacgaggtttctcattcttcttcaactcccactcattcaccttatcagctatatactc |
111 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4149557 |
taatattaggcactttcttccaatgctctctatcttcaggcttacgaggtttctcattcttcttcaactcccactcattcaccttatcagctatatactc |
4149656 |
T |
 |
| Q |
112 |
agctctcatgagcatatgtataactggattgttatacatttcgtttataaactc |
165 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
4149657 |
atatctcatgagcatatgtataattggattgttatacatttcgttcataaactc |
4149710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University