View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0585_low_5 (Length: 395)
Name: NF0585_low_5
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0585_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 96 - 154
Target Start/End: Complemental strand, 13013743 - 13013685
Alignment:
Q |
96 |
cccaagttctttaggttgttctactaggtagggtgctcttagccctggtgtcttcttgt |
154 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
13013743 |
cccaagttctttaggttgttctactaggtagggtgctcttagccttggtgtcttcttgt |
13013685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 96 - 154
Target Start/End: Complemental strand, 13084899 - 13084841
Alignment:
Q |
96 |
cccaagttctttaggttgttctactaggtagggtgctcttagccctggtgtcttcttgt |
154 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
13084899 |
cccaagttctttaggttgttctactaggtagggtgctcttagccttggtgtcttcttgt |
13084841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University