View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0585_low_5 (Length: 395)

Name: NF0585_low_5
Description: NF0585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0585_low_5
NF0585_low_5
[»] chr5 (2 HSPs)
chr5 (96-154)||(13013685-13013743)
chr5 (96-154)||(13084841-13084899)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 96 - 154
Target Start/End: Complemental strand, 13013743 - 13013685
Alignment:
96 cccaagttctttaggttgttctactaggtagggtgctcttagccctggtgtcttcttgt 154  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
13013743 cccaagttctttaggttgttctactaggtagggtgctcttagccttggtgtcttcttgt 13013685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 96 - 154
Target Start/End: Complemental strand, 13084899 - 13084841
Alignment:
96 cccaagttctttaggttgttctactaggtagggtgctcttagccctggtgtcttcttgt 154  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
13084899 cccaagttctttaggttgttctactaggtagggtgctcttagccttggtgtcttcttgt 13084841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University