View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_high_23 (Length: 360)
Name: NF0586_high_23
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 47 - 268
Target Start/End: Original strand, 23042497 - 23042718
Alignment:
| Q |
47 |
cacagtgccatactgagtggctggcaagctcgtgtatgggtttggttggcatattgttgagtcatctgctggaccaactgaagtggatgtttgaggaatc |
146 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23042497 |
cacagtgccataccgagtggctggcaagctcgtgtatgggtttggctggcatattgttgagtcatctgctgaaccaactgaagtggatgtttgaggaatc |
23042596 |
T |
|
| Q |
147 |
ttcttcatcccattttgctgctgcttctttatatatctttttcgtttccgttgttgcagtcgatgttgagttaaaatagaagctggtgttctgtgtttca |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23042597 |
ttcttcatcccattttgctgctgcttctttatatatctttttcgtttccgttgttgcagtcgacgttgagttaaaatagaagctggtgttctgtgtttca |
23042696 |
T |
|
| Q |
247 |
aatttgcattcggacctttcaa |
268 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23042697 |
tatttgcattcggacctttcaa |
23042718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 112 - 360
Target Start/End: Complemental strand, 22281826 - 22281578
Alignment:
| Q |
112 |
ctgctggaccaactgaagtggatgtttgaggaatcttcttcatcccattttgctgctgct---tctttatatatctttttcgtttccgttgttgcagtcg |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| ||| |||||||||||||||| |||| || ||| ||| ||| |||| |||||||| |
|
|
| T |
22281826 |
ctgctggaccaactgaagtggatgttcgaggaaccttgttc---ccattttgctgctgctgcttcttcattcttctcttttgttgccgtcgttgcagtgt |
22281730 |
T |
|
| Q |
209 |
atgttgagttaaaatagaagctggtgttctgtgtttcaaatttgcattcggacctttcaactgctctatacgctgttcaaggctagctagaggatattca |
308 |
Q |
| |
|
||| ||| ||| ||||||||||||||| |||| ||||| ||||| || | | || ||||| |||||||||||||| ||||||||| || |||||||||| |
|
|
| T |
22281729 |
atgctgatttagaatagaagctggtgtcctgtctttcatatttggatcctgccccttcaattgctctatacgctgctcaaggctatctcgaggatattcg |
22281630 |
T |
|
| Q |
309 |
gattccagagtatgattctccacaatctcaattaccgatttcagtgcacgca |
360 |
Q |
| |
|
||||| || ||||| |||| | ||||||||||||| ||||||| |||||| |
|
|
| T |
22281629 |
gattcaagcttatgaatctcaataatctcaattacccttttcagtacacgca |
22281578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1013 times since January 2019
Visitors: 3839