View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_high_38 (Length: 279)
Name: NF0586_high_38
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 43 - 214
Target Start/End: Complemental strand, 32428273 - 32428102
Alignment:
| Q |
43 |
gaaatttgcaaagatgaaatataatcttcaattttgccataatgaaaaacacataatagaggttgttgcaagcatgcaactccaccaaacagaagaaata |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32428273 |
gaaatttgcaaagatgaaatataatcttcaattttgccataatgaaaaacacataatagaggttgttgcaagcatgcaactccaccaaacagaagaaata |
32428174 |
T |
|
| Q |
143 |
tcaaactcaataacaatcactcaagttattacaacatgaaaatgagaatccaaatgtcttaatcttcatcac |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32428173 |
tcaaactcaataacaatcattcaagttattacaacatgaaaatgagaatccaaatgtcttaatcttcatcac |
32428102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1591 times since January 2019
Visitors: 3849