View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_high_43 (Length: 265)
Name: NF0586_high_43
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 38 - 255
Target Start/End: Complemental strand, 8452149 - 8451932
Alignment:
Q |
38 |
atacatggggtgaagcaaataagataaacaaaacatgggatgtataataagggaaattgaaagtgaaagagatcgagaaagaagagaaaacttaccttgg |
137 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
8452149 |
atacatggggtgaagcaaataagataaacaaaatatgggatgtataataagggaaattgaaagtgaaagagatcgagaaagaagaggaaacttaccttgg |
8452050 |
T |
 |
Q |
138 |
ttctcaaaggatgctcttgaagctgtttcacgtaactgttgagtccattctttgcaacagaactcatcttcctctgttcggttgtttggtttgaccggaa |
237 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8452049 |
ttctcaaaggatgctcttgaagctgtttcacgtaactgttgagtccattctttgcaacagaactcatcttcctctgttcggttgtttggtttgaccggaa |
8451950 |
T |
 |
Q |
238 |
agatgagttgcgtttgta |
255 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
8451949 |
agatgagttgcgtttgta |
8451932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University