View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_high_53 (Length: 250)
Name: NF0586_high_53
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 107 - 249
Target Start/End: Original strand, 39414038 - 39414182
Alignment:
Q |
107 |
tacaggtgtgatgattttgggctgagtc--tattttttgatacatg-atgtgccgtgtcactgaaccaatgccaactcatggtcnnnnnnnatgacaatg |
203 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| || || || ||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
T |
39414038 |
tacaggtgtgatgattttgggctgagtcaatatttttggacacgtggatgtgccgtgtcactgaaccaatgccaactcgtggtctttttcgatgacaatg |
39414137 |
T |
 |
Q |
204 |
ttaacgagggactaaaatataaatgggttcaaatatcataggggta |
249 |
Q |
|
|
|||| |||||||| |||||||||||||||||||||| ||||||||| |
|
|
T |
39414138 |
ttaatgagggact-aaatataaatgggttcaaatattataggggta |
39414182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University