View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_high_55 (Length: 248)
Name: NF0586_high_55
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 7e-30; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 100 - 211
Target Start/End: Complemental strand, 25872650 - 25872544
Alignment:
Q |
100 |
tagcgcttttgtcttgactactttgattgattgtatatgtcttttttcacggttttaccttaagttaactttgtttatgttcaaattataaaatttaatt |
199 |
Q |
|
|
|||||||||| |||||||||||||||||| |||||||| ||||||||||||||| ||| ||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
25872650 |
tagcgcttttatcttgactactttgattg----tatatgtcctttttcacggttttatctttagttaactttg-ttatgttcaaatcataaaatttaatt |
25872556 |
T |
 |
Q |
200 |
aatatttagagt |
211 |
Q |
|
|
|||||||||||| |
|
|
T |
25872555 |
aatatttagagt |
25872544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 142 - 211
Target Start/End: Complemental strand, 25864109 - 25864041
Alignment:
Q |
142 |
tttttcacggttttaccttaagttaactttgtttatgttcaaattataaaatttaattaatatttagagt |
211 |
Q |
|
|
|||||| |||||||||||| ||| ||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
T |
25864109 |
tttttctcggttttacctttagtcaactttgtt-atgttcaaattttaaaatttagttaatatttagagt |
25864041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 25872749 - 25872715
Alignment:
Q |
1 |
tttatgtcaacaaataatgcaaattagtaaaatga |
35 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
25872749 |
tttatgtcaacaaataatgcaaattagtaaaatga |
25872715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 202
Target Start/End: Complemental strand, 25855495 - 25855467
Alignment:
Q |
174 |
ttatgttcaaattataaaatttaattaat |
202 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
25855495 |
ttatgttcaaattataaaatttaattaat |
25855467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 25864266 - 25864234
Alignment:
Q |
1 |
tttatgtcaacaaataatgcaaattagtaaaat |
33 |
Q |
|
|
||||||||||||||||||||||| ||||||||| |
|
|
T |
25864266 |
tttatgtcaacaaataatgcaaaatagtaaaat |
25864234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 207
Target Start/End: Original strand, 17251619 - 17251674
Alignment:
Q |
151 |
gttttaccttaagttaactttgtttatgttcaaattataaaatttaattaatattta |
207 |
Q |
|
|
|||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
T |
17251619 |
gttttacctttagttaactttgtt-atgttcaaattataaaatttatttaatattta |
17251674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1589 times since January 2019
Visitors: 3849