View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_high_57 (Length: 204)
Name: NF0586_high_57
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_high_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 6082043 - 6081918
Alignment:
Q |
1 |
tagaacatagaagttgagaaagtaaagagaacaatgaatatgataacgtgttgtgcttgatatctcaccgacgctctgagttcaaggaaaatgactcaca |
100 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6082043 |
tagaacatagaagttgagaaagtgaagagaacaatgaatatgataacgtgttgtgtttgatatctcaccgacgctctgagttcaaggaaaatgactcaca |
6081944 |
T |
 |
Q |
101 |
ctcctcaactaacaactatctctgct |
126 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
6081943 |
ctcctcaactaacaactatctctgct |
6081918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1463 times since January 2019
Visitors: 3846