View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_26 (Length: 403)
Name: NF0586_low_26
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 129 - 297
Target Start/End: Original strand, 33268572 - 33268742
Alignment:
| Q |
129 |
acttaatatgaaattggtttgacannnnnnn--gtcttctgctgtaagaaagctcaatttgttgactttgaatataagaaagcttaatttagttgatttt |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268572 |
acttaatatgaaattggtttgacattttttattgtcttctgctgtaagaaagctcaatttgttgactttgaatataagaaagcttaatttagttgatttt |
33268671 |
T |
|
| Q |
227 |
tcaagttaattgtcttgtttagttagatggaatcctaaaattttatatatttcctaatagttccttctggg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268672 |
tcaagttaattgtcttgtttagttagatgcaatcctaaaattttatatatttcctaatagttccttctggg |
33268742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 33268444 - 33268504
Alignment:
| Q |
1 |
gttgggagctttattgtcttgagcatggaattcaacctgatggattgatgcctaggtacac |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268444 |
gttgggagctttattgtcttgagcatggaattcaacctgatggattgatgcctaggtacac |
33268504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 10034513 - 10034470
Alignment:
| Q |
1 |
gttgggagctttattgtcttgagcatggaattcaacctgatgga |
44 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10034513 |
gttgggagctatattgtcttgaacatggcattcaacctgatgga |
10034470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 496 times since January 2019
Visitors: 3834