View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_32 (Length: 388)
Name: NF0586_low_32
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 2e-31; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 299 - 376
Target Start/End: Complemental strand, 5805973 - 5805896
Alignment:
| Q |
299 |
ctgcagaattttccaagaatttattatacagctaagatacgtgaggattttgcttcaaaactgtttcctgtctatatt |
376 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5805973 |
ctgcagaattttccaagaatttattagacagctaagatatgtgaggattttgcttcaaaactgtttcctgtctatatt |
5805896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 188 - 243
Target Start/End: Complemental strand, 5806084 - 5806029
Alignment:
| Q |
188 |
cggttcattaacaaatgttgtgacttcaattcaaaatggtccatattcaattagca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5806084 |
cggttcattaacaaatgttgtgacttcaattcaaaatggtccatattcaattagca |
5806029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 70 - 114
Target Start/End: Original strand, 39488893 - 39488937
Alignment:
| Q |
70 |
ttcattgttgctgactgtttagatattttgtttagtttattaaat |
114 |
Q |
| |
|
|||||| ||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
39488893 |
ttcattattgttgactgtttagacattttggttagtttattaaat |
39488937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University