View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_37 (Length: 359)
Name: NF0586_low_37
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 5863099 - 5862775
Alignment:
| Q |
1 |
acatgaaatgttggaaacgcaacgttgattagtttattccatcacgtacatgacaaaaaa-gtaccgcttttaatttttaaaagataaaaggtaccactt |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5863099 |
acatgaaaagttggaaacgcaacgttgattagtttattccatcacgtacatgacaaaaaaagtaccgcttttaatttttaaaagataaaaggtaccactt |
5863000 |
T |
|
| Q |
100 |
gctaattattcaaggaagagaacattattgagctcgaaatcttgacaaattttagctgctatgaaaataacgttgtttgctgtcgttagttagatcttgt |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5862999 |
ggtaattattcaaggaagagaacattattgagctcgaaatcttgacaaattttagctgctatgaaaataacgttgtttgctgtcgttagttagatcttgt |
5862900 |
T |
|
| Q |
200 |
gtggggttgctgcgataacttcaacaaggagaagacgatgctgaatatgaattgcacaaacaaatttcaaagtgtatgtaaagacactaaattttaagct |
299 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||| ||| |
|
|
| T |
5862899 |
gtggggttgctgcgataacttgaacaaggagaagacgatgctgaatatgaattgcacaaacaaatgtcaaagtgcatgtaaacacactaaattttaggct |
5862800 |
T |
|
| Q |
300 |
tgattgactcata-ttgtttgtgct |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
5862799 |
tgattgactcatatttgtttgtgct |
5862775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 437 times since January 2019
Visitors: 3834