View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_39 (Length: 350)
Name: NF0586_low_39
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_low_39 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 77 - 350
Target Start/End: Complemental strand, 34785620 - 34785347
Alignment:
Q |
77 |
agcagagacattcaaatttggaaccattcctgttgtaaggttcagcttcattgctattatactatatattattccaatcatcatactcacaaacaatcct |
176 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34785620 |
agcagagacattcaaatttggaaccattcctgttgtaaggttcagcttcattgctattatactatatattattccaatcatcatactcacaaacaatcct |
34785521 |
T |
 |
Q |
177 |
ctcactgttatgtgttctgtccaatgttcatcggattggattacttcagctcctataactggcaacctttcttccatattctgattaatatctctttcaa |
276 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34785520 |
ctcactgttatgtgttctgtccaatgttcatcggattggattacttcagctcctataactggcaacctttcttccatattctgattaatatctctttcaa |
34785421 |
T |
 |
Q |
277 |
tttccannnnnnnctcaccaaattccatgttgatgtttagtggacttgatggagaaatcatctttataacttac |
350 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34785420 |
tttccatttttttctcaccaaattccatgttgatgtttagtggacttgatggagaaatcatctttataacttac |
34785347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 443 times since January 2019
Visitors: 3834