View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_42 (Length: 330)
Name: NF0586_low_42
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 36127831 - 36127961
Alignment:
| Q |
1 |
gaagttgagttgacattgaagctagggatgaagaattagcacttgtcgagaatttgttcaagaattgaattatatgtgcttgtctatcaccagcaatagc |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127831 |
gaagttgagttgacattgaagttagggatgaagaattagcacttgtcgagaatttgttcaagaattgaattatatgtgcttgtctatcaccagcaatagc |
36127930 |
T |
|
| Q |
101 |
ttgttcatgtgccatcaactcaagctctttg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36127931 |
ttgttcatgtgccatcaactcaagctctttg |
36127961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 200 - 323
Target Start/End: Original strand, 36128030 - 36128153
Alignment:
| Q |
200 |
catatcttcaataagcttgttgtgcatttcttcttgttgatccatcattttctttacaacactctcacaaaaacccttaaacacttcaaatctatcatca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36128030 |
catatcttcaataagcttgttgtgcatttcttcttgttgatccatcattttctttacaacactctcacaaaaacccttaaacacttcaaatctatcatca |
36128129 |
T |
|
| Q |
300 |
cctgatcttttcctcttcatctca |
323 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
36128130 |
cctgatcttttcctcttcttctca |
36128153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 204 - 296
Target Start/End: Complemental strand, 47422367 - 47422275
Alignment:
| Q |
204 |
tcttcaataagcttgttgtgcatttcttcttgttgatccatcattttctttacaacactctcacaaaaacccttaaacacttcaaatctatca |
296 |
Q |
| |
|
||||||| ||||| ||||| |||||||||||||| | || ||||| || || || |||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
47422367 |
tcttcaagtagcttattgtgtatttcttcttgttgtgctattattttattaaccactgtctcacaaaaactcttcaacatttcaaatctatca |
47422275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1454 times since January 2019
Visitors: 3846