View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_46 (Length: 321)
Name: NF0586_low_46
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 293
Target Start/End: Complemental strand, 41975781 - 41975507
Alignment:
| Q |
16 |
attaaaaacagaagagagggcttgtgaagtgcttctatttttgaaagtatgtcttgaaatagtttccaatcaaacacttctatttttaatagaactccat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
41975781 |
attaaaaacagaagagagggcttgtgaagtgcttctatttttgaaagtctgtcttgaaatagtttccaatcaaacacttctatttttaataaaactc-at |
41975683 |
T |
 |
| Q |
116 |
tcttacacaacaggatcagtgcatagcgcatgcttgattttatttagacctattgtcgatttgcgcaatgataaaggaaaattaaattttcacactaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||| ||||||||||| |
|
|
| T |
41975682 |
tcttacacaacaggatcagtgcatagcgcatgcttgattttatttagacctattgtcgatttgc--aatgataaggaaaaattaaattgtcacactaaat |
41975585 |
T |
 |
| Q |
216 |
cacattcatcctatttataatccaagtctcttgttaggttaattctgtactgcttttacaccttccaacaataaatct |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41975584 |
cacattcatcctatttataatccaagtctcttgttaggttaattttgtactgcttttacaccttccaacaataaatct |
41975507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University