View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0586_low_48 (Length: 316)

Name: NF0586_low_48
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0586_low_48
NF0586_low_48
[»] chr7 (1 HSPs)
chr7 (73-225)||(44347706-44347859)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 73 - 225
Target Start/End: Complemental strand, 44347859 - 44347706
Alignment:
73 cataggcgaaaaagttatctttgtgggttgaaaggaagtcgttcgttacaccactcggcaaattagaatgaaataattacactccggttgtgactgtgac 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44347859 cataggcgaaaaagttatctttgtgggttgaaaggaagtcgttcgttacaccactcggcaaattagaatgaaataattacactccggttgtgactgtgac 44347760  T
173 cgtgaatgtaggtccatgatgtagctat-atattgttttactgtggacatcttt 225  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||    
44347759 cgtgaatgtaggtccatgatgtagctataatattgttttactgtggacatcttt 44347706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1125 times since January 2019
Visitors: 3840