View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_48 (Length: 316)
Name: NF0586_low_48
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 73 - 225
Target Start/End: Complemental strand, 44347859 - 44347706
Alignment:
| Q |
73 |
cataggcgaaaaagttatctttgtgggttgaaaggaagtcgttcgttacaccactcggcaaattagaatgaaataattacactccggttgtgactgtgac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44347859 |
cataggcgaaaaagttatctttgtgggttgaaaggaagtcgttcgttacaccactcggcaaattagaatgaaataattacactccggttgtgactgtgac |
44347760 |
T |
 |
| Q |
173 |
cgtgaatgtaggtccatgatgtagctat-atattgttttactgtggacatcttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44347759 |
cgtgaatgtaggtccatgatgtagctataatattgttttactgtggacatcttt |
44347706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University