View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_49 (Length: 313)
Name: NF0586_low_49
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 40750191 - 40749969
Alignment:
Q |
1 |
ttgagctgctttctgaagaagtgcagtagctgacattggagtattagtttgagccatttgtataacatcggaaaaacctgatgaaacatgatcaagtgaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40750191 |
ttgagctgctttctgaagaagtgcagtagctgacattggagtattagtttgagccatttgtataacatcggaaaaacctgatgaaacatgatcaagtgaa |
40750092 |
T |
 |
Q |
101 |
tatgaatgatgattaatctgttgattttcttggttcaaccacagtgacaagtttggtctttgctcatgatgaaatcctgcatgtggactaaactgttgaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
40750091 |
tatgaatgatgattaatctgttgattttcttggttcaaccacagtgacaaatttggtctttgctcatgatgaaatcctgcatgtggactaaattgttgaa |
40749992 |
T |
 |
Q |
201 |
gattttgaagtccttgagatgat |
223 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
40749991 |
tattttgaagtccttgagatgat |
40749969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 50785491 - 50785528
Alignment:
Q |
1 |
ttgagctgctttctgaagaagtgcagtagctgacattg |
38 |
Q |
|
|
|||||| |||||||||||||||||||| |||||||||| |
|
|
T |
50785491 |
ttgagcagctttctgaagaagtgcagttgctgacattg |
50785528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1399 times since January 2019
Visitors: 3846