View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_54 (Length: 296)
Name: NF0586_low_54
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 78 - 208
Target Start/End: Original strand, 3959411 - 3959541
Alignment:
| Q |
78 |
aggactggagtgaggtgcagctcccttttgcagaatgaaacacaacaaagtttaactcagaggcatggtttataatactggttgtgtctttagttccctc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959411 |
aggactggagtgaggtgcagctcccttttgctgaatgagacacaacaaagtttaactcagaggcatggtttataatactggttgtgtctttagttccctc |
3959510 |
T |
 |
| Q |
178 |
gttttctatgttcccattttgaggtaaactg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3959511 |
cttttctatgttcccattttgaggtaaactg |
3959541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 207 - 276
Target Start/End: Original strand, 3959779 - 3959848
Alignment:
| Q |
207 |
tggtacatatatatgccctttatcgttggtgaaacttatatagtaaatatatcccttcttctctgctcct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3959779 |
tggtacatatatatgccctttatcgttggtgaaacttatatagtaaatatatcccttcttttctgctcct |
3959848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 208
Target Start/End: Complemental strand, 19167705 - 19167640
Alignment:
| Q |
144 |
ggtttataatactggttgtgtctttagttccctcgttttctatgttccc-attttgaggtaaactg |
208 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || ||||| ||||||| ||||||| |||||||| |
|
|
| T |
19167705 |
ggtttataatattggttgtgtctttagttccttccatttctttgttcccaattttgaagtaaactg |
19167640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University