View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_57 (Length: 291)
Name: NF0586_low_57
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 7296728 - 7296588
Alignment:
| Q |
1 |
tttaagctcactgatttttatttgttattagtgtcgtataaaaacttgtaatcaaagtaaaatatattaaactggtaaagtgtcaaaacctgcacaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296728 |
tttaagctcactgatttttatttgttattagtgtcgtataaaaacttgtaatcaaagtaaaatatattaaactggtaaagtgtcaaaacctgcacaagac |
7296629 |
T |
|
| Q |
101 |
gtgtttgaaaacgacactaaagtatctaagtataataatct |
141 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7296628 |
gtgtttgaaaacgacattaaagtatctaagtataataatct |
7296588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 135
Target Start/End: Original strand, 12781931 - 12782005
Alignment:
| Q |
61 |
aatatattaaactggtaaagtgtcaaaacctgcacaagatgtgtttgaaaacgacactaaagtatctaagtataa |
135 |
Q |
| |
|
||||||||||||| | |||||||| |||| ||||||| || | ||||||| |||||||||||||| |||||||| |
|
|
| T |
12781931 |
aatatattaaacttgaaaagtgtcgaaactagcacaaggtgcgcttgaaaatgacactaaagtatcaaagtataa |
12782005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1234 times since January 2019
Visitors: 3841