View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_64 (Length: 268)
Name: NF0586_low_64
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 47 - 241
Target Start/End: Original strand, 23042497 - 23042691
Alignment:
| Q |
47 |
cacagtgccatactgagtggctggcaagctcgtgtatgggtttggttggcatattgttgagtcatctgctggaccaactgaagtggatgtttgaggaatc |
146 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23042497 |
cacagtgccataccgagtggctggcaagctcgtgtatgggtttggctggcatattgttgagtcatctgctgaaccaactgaagtggatgtttgaggaatc |
23042596 |
T |
 |
| Q |
147 |
ttcttcatcccattttgctgctgcttctttatatatctttttcgtttccgttgttgcagtcgatgttgagttaaaatagaagctggtgttctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23042597 |
ttcttcatcccattttgctgctgcttctttatatatctttttcgtttccgttgttgcagtcgacgttgagttaaaatagaagctggtgttctgtg |
23042691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 240
Target Start/End: Complemental strand, 22281826 - 22281698
Alignment:
| Q |
112 |
ctgctggaccaactgaagtggatgtttgaggaatcttcttcatcccattt---tgctgctgcttctttatatatctttttcgtttccgttgttgcagtcg |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| | |||||||| |||||||||||||| || ||| ||| ||| |||| |||||||| |
|
|
| T |
22281826 |
ctgctggaccaactgaagtggatgttcgaggaaccttgt---tcccattttgctgctgctgcttcttcattcttctcttttgttgccgtcgttgcagtgt |
22281730 |
T |
 |
| Q |
209 |
atgttgagttaaaatagaagctggtgttctgt |
240 |
Q |
| |
|
||| ||| ||| ||||||||||||||| |||| |
|
|
| T |
22281729 |
atgctgatttagaatagaagctggtgtcctgt |
22281698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University